Seudónimo Seudónimo
  • 02-02-2016
  • English
contestada

Correct the sentence:

Me and My friends went to Bambi.

Respuesta :

bshawy89
bshawy89 bshawy89
  • 02-02-2016
My friend and I went to see Bambi. 
Answer Link
Аноним Аноним
  • 02-02-2016


My friends and I went to Bambi.


Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
How did the mountains in Greece contribute to the rise of city-states?
What is the difference between "Herr" and "Herrn"?
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
What were the driving forces behind the industrial revolution