hamzaayaz333 hamzaayaz333

01-07-2017
Mathematics

contestada

In the figure above, two line segments in the x-y plane form a right triangle with the x-axis. What is the area of the triangle ?

Help!

In the figure above two line segments in the xy plane form a right triangle with the xaxis What is the area of the triangle Help class=

Respuesta :

01-07-2017

A = (1/2) * b * h
The base is 10; the x-value going from 0 to 10.
The perpendicular height is 2; the y-value going from 0 to 2
A = (1/2) * 10 * 2
A = 10 units ^2

Answer Link

Otras preguntas

If your company has a large production-related task, such as assembling an airplane, what strategy could help you increase productivity?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Some puritans wanted to separate from the Church of England

One year ago liz was three times as old as her brother jack. in two years she'll be only twice as old as jack. how old are liz and jack now?

Nigeria’s economy has relied on its oil industry to create jobs . When world oil prices dropped , their economy collapsed. This is a problem primarily caused by

Which phrase states a principle that was part of president woodrow wilson's fourteen points?

Which phrase best describes the New World Order?

(hc) "in the government of this commonwealth, the legislative department shall never exercise the executive and judicial powers, or either of them. the executiv

Which constitutional amendment allowed voting for citizens who were eighteen or older?

Which absorption rate of minerals is faster plant foods or animal foods?