Shortykatiemcmiken20 Shortykatiemcmiken20

04-06-2017
Mathematics

contestada

Is the answer number 1? I can't get anymore wrong sorry for lengthy problem thanks!

Is the answer number 1 I cant get anymore wrong sorry for lengthy problem thanks class=

Respuesta :

kevinlpublic kevinlpublic

04-06-2017

The area of the circle shown would not be 5pi. If you look closer, the area is 25pi, therefore the answer is 3. I hope this helps!

Answer Link

Otras preguntas

2(3+x)=18 what does x equal

Hello! I need help in answering question number 3 which I will attach. Geometry 3 D shapes. It reads To make one order you need to fill the cone with ice cream

A suit is on sale for $217, which is 62% of the regular price

Hi, can you help me to find (Ir possible) the complement andsupplement of the angle of exercise

Hello looking for someone to help me out on this question

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

State the domain and range of the relation. Then determine whether the relation is a function, write yes or no.

The center of dilation, the original point, and its image do not line up on the same ray. ** is this true or false?

Need help with this graphing and W X and Y

Can someone help me with this? Please and thank you