Dumbestllama Dumbestllama
  • 01-04-2017
  • Mathematics
contestada

2 and 4 seemed really confusing , please help :(

2 and 4 seemed really confusing please help class=

Respuesta :

baabaagreysheep
baabaagreysheep baabaagreysheep
  • 01-04-2017
2. This question is basically asking you to factor 6x² - x - 12, so that one bracket is (2x - 3) and the other bracket is your answer. If you do factor 6x² - x - 12, you get (2x - 3)(3x + 4), so your answer would be J. 3x + 4.

4. Again you are factoring, so you would get your answer as (x + 3)(x - 2), which is answer F.

I hope this helps! Let me know if you would like me to show you how I factored :)
Answer Link

Otras preguntas

What are some methods used by Mussolini to rise to power?
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
What was George Washington's nickname?
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What Role Does the Sun Play in Producing Winds And Ocean Currents
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3