z4oe6gergestcody z4oe6gergestcody
  • 01-04-2017
  • Mathematics
contestada

Two angles form a right angle. one angle measures 45 degrees. what is the measure if the other angle?

Respuesta :

annaxmary
annaxmary annaxmary
  • 01-04-2017
45. 90-45=45. right angle means 90.
Answer Link
Аноним Аноним
  • 01-04-2017
Hello there.

Question: Two angles form a right angle. one angle measures 45 degrees. what is the measure if the other angle?

Answer: A right angle is always 90
°.
90 - 45 = 45.
The other angle would be 90°.
There are many types of angles.
Some are acute, obtuse and right angles.

In short, Your answer is 45°.

Hope This Helps You!
Good Luck Studying ^-^
Answer Link

Otras preguntas

A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
What are the factors of 6x + 24?
Help pl0x, Algebra 1
Give a recursive algorithm for finding the sum of the first n odd positive integers.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
the temperature of a sample of matter is a measure of the ?
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
3+1/4x greater than 11