caleigh3 caleigh3
  • 01-03-2017
  • Mathematics
contestada

I don't know how to do this problem

I dont know how to do this problem class=

Respuesta :

aly45 aly45
  • 01-03-2017
a. 180
b. 230
c. I'm not sure what that on is
Answer Link

Otras preguntas

how do you know 8 thousandths is less than 1 hundredths
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
how do you know 8 thousandths is less than 1 hundredths
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
How do you write fifty-seven thousand,eighteen. In standard form
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources