niviabraga27 niviabraga27
  • 03-01-2022
  • Biology
contestada

What is a possible benefit of startling plants in the rain forest

Respuesta :

kd8wbdcksq kd8wbdcksq
  • 03-01-2022
Rain forest plants all work together to provide food and shelter for rain forest animals, as well as to convert carbon dioxide to oxygen. Ground-level competition for light and food has resulted in some unusual plant evolution.
Answer Link
25204098 25204098
  • 03-01-2022

Answer:

All of the rain forest plants work to provide food and shelter for rain forest animals as well as convert carbon dioxide to oxygen.

Explanation:

( i hope u meant starting instead startling lol)

Answer Link

Otras preguntas

Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Where did middle names come from
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
How much money, in dollars, does one mole of nickels represent?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
What is the sum of 6/10 plus 7/12
how do you say theatre in Spanish
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.