dunny5 dunny5
  • 04-06-2021
  • Mathematics
contestada

help please help please

help please help please class=

Respuesta :

CarHo
CarHo CarHo
  • 04-06-2021

Answer:

Angle 1 = 123 degrees

Step-by-step explanation:

Answer Link
allieelizabeth7607
allieelizabeth7607 allieelizabeth7607
  • 04-06-2021
i think it’s 123° :))))))
Answer Link

Otras preguntas

True or false? physical factors affecting community health include geography, community size, and industrial development.
How was fidel castro able to maintain cuba's independence as a communist state while only being 90 miles off the coast of the united states?
Compare or Contrast - Jack London's "War" and Ambrose Bierce's "Horseman in the Sky." DUE TODAY!!!
Please help with geometry!!!
The right to a trial by jury in a criminal case is outlined in which amendment?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which option would best fit in this diagram in the bubble labeled 1?
Vince chooses 3 side dishes from a total of 10 side dishes offered on the menu is how many different ways can he choose
Find the absolute maximum and minimum values of the function f(x, y) = x2 + xy + y2 on the disc x2 + y2 ≤ 1. (you do not have to use calculus.)
Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)