ajlemontree ajlemontree
  • 03-06-2021
  • Mathematics
contestada

Triangle FEG is similar to triangle IHJ. Find the value of y.

Triangle FEG is similar to triangle IHJ Find the value of y class=

Respuesta :

Shark12345 Shark12345
  • 03-06-2021

Answer:

the answer i got is 10

Step-by-step explanation:

if the triangles are similar than

59 = 5y + 9

now solve for y

59 - 9 = 5y

50 = 5y

50/5 = y

10 = y

Answer Link

Otras preguntas

What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
3+1/4x greater than 11
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
What is the primary purpose of the Supremacy Clause?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud