calli729 calli729
  • 03-05-2021
  • Mathematics
contestada

4 thirds divided by 2 fifths

Respuesta :

vuori
vuori vuori
  • 03-05-2021

Answer:

10/3 aka 3 1/10

Step-by-step explanation:

Answer Link
TheUnknownScientist
TheUnknownScientist TheUnknownScientist
  • 03-05-2021

Answer:

The answer is 10/3

Step-by-step explanation:

4 thirds divided by 2 fifths

4/3 ÷ 2/5

4/3 × 5/2

4 × 5 ÷ 3 × 2 = 20 ÷ 6 = 10/3

Thus, The answer is 10/3

-TheUnknownScientist

Answer Link

Otras preguntas

Who was the u.s. general fired during the korean war for trying to create another world war with china?
What did Theodore Roosevelt do before he was elected president at the age of 42?
Which of the following is a run-on sentence?
The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?
Can someone please help me with numbers 1, a, b, c, 2, a, b, c
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
what was a power given by the articles of confederation
1. Read this excerpt from The Narrative of the Life of Frederick Douglass. I could not approach her as I was accustomed to approach other white ladies. My early
Concerns over the Spanish treatment of what nation help lead to the Spanish–American War? A. Hawaii B. Portugal C. Canada D. Cuba
Why do you think the Little Rock Nine deserve to be admired? Give two reasons for your opinion.