abraralakbari2007 abraralakbari2007

02-05-2021
Mathematics

contestada

Find the volume of the cylinder. Use 3.14 to approximate π. Round your answer to the nearest tenth.

V =

Find the volume of the cylinder Use 314 to approximate π Round your answer to the nearest tenth V class=

Respuesta :

tanny00 tanny00

02-05-2021

Answer:

V≈100.5

Step-by-step explanation:

V=πr2h=π·22·8≈100.53096

Answer Link

Otras preguntas

who is the present president of liberia

A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Adair needs $21,150 to purchase a boat. How much money will you need to invest today in a savings account earning 3.2% interest, compounded monthly, to have en

Observing people and asking them questions are the two principal ways to obtain

A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart

100 points to whoever answers this question!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height (in meters) f

Remembering how to ride a bicycle, even though you have not ridden one for years, is an example of _____ memory.

Read each verbal expression Then assign a variable and distribute

What major events led to the establishment of the navy and the department of the navy?