kemmykris123
kemmykris123 kemmykris123
  • 04-02-2021
  • English
contestada

write an explanatory writing on the the title "A job for me"

Respuesta :

Аноним Аноним
  • 04-02-2021

Answer:

Explanation:

2. A Job for Me

People do all kinds of jobs. Some people build. Others serve. Some teach. Others sell. Some people work on ships at sea, and others in skyscrapers in cities. What kind of job would you like to do? As a future worker, write an essay that names a job you would like, describes the work, and tells why you would like it.

Answer Link

Otras preguntas

Five causes of world war 2
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
In a paragraph with the topic sentence "Having pets can keep older people from getting too lonely," which of the following would be a good supporting sentence?
Parallel, intersecting or skew? AB and BC. AE and BF. EF and AD. Plane ABC and Plane ABF. Plane AED and Plane BFC. HELP!!!
Which is an outer planet?
w 2. Who helps Aschenputtel pick up the lentils out of the ashes? a. birds b. squirrels c. mice d. rabbits
This is confusing (2x+y)^2−(x−2y)^2
A function is defined by f (x) = 3 x + 1. What is f(10)? - 11 - 14 - 31 - 311
The square root of 198 is between witch two numbers?
What were the challenges facing the German people after the Berlin Wall came down?