vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

Simplify the radical expression by rationalizing the denominator. 2 divided by the square root of 30.
What is 21 divided by 94.5
Which expression means 63? A) 6 × 3 B) 6 × 6 × 6 C) 3 × 3 × 3 × 3 × 3 × 3 D) (2 × 3) × (2 × 3) × (2 × 3)
What colors of light are combined in a television to produce thousands of different colors?
Write 60 divided 10 in three different ways
Your bank account balance is -$20.85. You deposit $15.50. What is your new balance?
find the inverse of the function f(x) =4x+6
To make this equation true we need parentheses 15 + 3 ÷ 3 = 6 A) nowhere B) around 3 ÷ 3 C) around 15 + 3 D) ar
The automobile industry was uniquely suited to the mass production of a. “Government Issue” clothing. c. military equipment. b. ships. d. buildings to house sol
Use the distributive property to express 15+45