taziiiiaaahhh taziiiiaaahhh

02-12-2020
Geography

contestada

Explain the 5 spheres of earth
Pls help

Respuesta :

keenen54 keenen54

02-12-2020

Answer:

geosphere hudrosphere atmosphere cryosphere biosphere

Explanation:

they are the 5 spheres of the earth

Answer Link

Otras preguntas

help me asap !!!!!!!!

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Renaissance painters in flanders as in italy tended to produce work that was

The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac

Which constitutional amendment allowed voting for citizens who were eighteen or older?

can anyone help me to solve these 2 questions please I need very clear steps !!!!

The introduction of the Green Revolution in India was intended to

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

the height h in feet of a projectile launched upward at a speed of 32 feet/ second from a height of 48 feet is given by the function : h(t) =16^2+32t +48. how l

Insulin is a protein that is used by the body to regulate both carbohydrate and fat metabolism. a bottle contains 425 ml of insulin at a concentration of 20.0 m