heilygavino16 heilygavino16

01-12-2020
Chemistry

contestada

When using a light microscope, focus the specimen with the scanning objective
lens first.
Reasoning:

Respuesta :

00081094 00081094

01-12-2020

Answer:

The light microscope bends a beam of light at the specimen using a series of lenses to provide a clear image of the specimen to the observer.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Can things of aluminum have a greater mass than things made of iron?

Can someone Help me with that please

Towards the end of Anne's diary, her entries stop being about her relationship with Peter and focuses more on what? the burglaries in the house the food

When a molecule can best be represented as a series of resonance forms, each of these forms always contributes to the same degree in the hybrid?

a school cafeteria makes 4 diffrent salads during the week but serves only 2 salads each day on a roating basis. salads: chicken,fruit,pasta,tuna. a student ran

Which of the following is true about a writer’s diction? a.When the writer uses sophisticated vocabulary, the diction is informal. b.When the writer uses comple

Quadrilateral abcd is inscribed in this circle. what is the measure of angle a?

4 (2x-6)=10x-6. solve for x

A carpenter is making a blanket chest based on an antique chest. Both chests have the shape of a rectangular prism. The length width and height of the new chest