sulaikhamalin123 sulaikhamalin123

02-10-2020
Social Studies

contestada

what represents the location of the Baker Island?

Respuesta :

10c32sanskritee 10c32sanskritee

02-10-2020

Baker Island is an uninhabited atoll located just North to the equator in the central Pacific Ocean at 0 degree 13`N 176 degree 31` W about 3,100 km south west of Honolulu.

HOPE IT HELPS!!!!!!

Answer Link

Otras preguntas

PLS HELP ME (i will give brainliest) I’m not very smart. using 3.14 or 22/7. what is the circumference of these 3 circles.

Describe and name the mountains, rivers, and plains of South America.

Jim’s pay is £180 each week. Jim asks his boss for an increase of £20 a week. Jim’s boss offers him a 10% increase. Find how much Jim will be paid with the incr

help im famous biologist .................................................................. please daddy

A magnet produces a magnetic field. Which diagram shows the magnetic field pattern around a bar magnet

What transformations were applied to ABCD to obtain A'B'C'D?

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

medium of 8,9, 10, 10, 11, 11, 11, 12, 13

Which word best completes the sentence? Select the word from the drop-down menu He is quite Choose... despite never having left his smalL TOWEN

The space shuttle a) can only be used once b) can be used many times to carry astronauts into orbit c)is an uncrewed space probe d)carried astronauts to the moo