Savalas75 Savalas75
  • 01-11-2018
  • History
contestada

and what year did Columbus sail the ocean blue

Respuesta :

Meowthteam
Meowthteam Meowthteam
  • 01-11-2018

1492 is the year he set sailed

Answer Link

Otras preguntas

what are the short term affects of decline in bee population?
Which research questions would be the most effective in researching the effects of television on children? Check all that apply. What are the most popular telev
Cole's rectangular garden has of 54 square feet. What could dimensions of the garden? gular garden has an area et. What could be the
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
whats the theme of night walk
Write each set of fractions with the lowest common denominator and then find which fraction is greater. 4/7 and 5/8 3/8 and 4/9 5/6 and 7/8 3/10 and 4/15
It costs $7.00 to purchase a pair of goggles. then marks the goggles up by 75%. How much does Sam charge for a pair of goggles ?
How do you calculate torque?
In the diagram, q1 = +0.250 mC, q2 = -0.180 mC, and q3 = +0.400 mC. the net force on q2 is zero. how far is q2 from q3? (make sure you know the direction of ea
The fact that the zebra's stripes are passed down in its DNA indicates that the stripes may serve an evolutionary advantage. What do you think is the evolutiona