CupcakeQueen26 CupcakeQueen26

04-09-2018
Mathematics

contestada

I need the answer for tomorrow
Help me plz? And show your work

I need the answer for tomorrowHelp me plz And show your work class=

Respuesta :

anishkon04 anishkon04

04-09-2018

It would be 13 because the line is perpendicular and it is equal

Answer Link

Otras preguntas

which function has the solution set shown in the graph?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Really need some helpUse the diagram below. Write AD/AB in simplest form.

if 2^x-4=4a^x-6 what is the value of a

Which country is the world’s largest producer of wheat? USA China Russia France

2. For centuries, Africans enslaved other Africans. Name the two later slave trades that transported millions of Africans to distant lands to work.

A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil

I just need a confirmation that my answer is right? Find side AC. Round to the nearest hundredth. The angles are: Angle A = 40°, Angle C = 90°, and Angle B = 50

What is the difference between a settler an an explorer social studies?

A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.